View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14942_low_24 (Length: 216)
Name: NF14942_low_24
Description: NF14942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14942_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 53 - 176
Target Start/End: Original strand, 39688845 - 39688968
Alignment:
| Q |
53 |
tccatgctatgataacaacagtgttacattcttcacctgtatagataataacatatctttgattaattattgcacaatgataccaatatgtaaccattga |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39688845 |
tccatgctatgataacaacagtgttacattcttcacctgtgtagataataacatatctttgattaattattgcacaatgataccaatatgtaaccattga |
39688944 |
T |
|
| Q |
153 |
gataaatgtgaaagtgaaatgtgt |
176 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
39688945 |
gataaatgtgaaagtgaaatgtgt |
39688968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University