View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14942_low_3 (Length: 492)
Name: NF14942_low_3
Description: NF14942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14942_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 390; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 390; E-Value: 0
Query Start/End: Original strand, 18 - 481
Target Start/End: Complemental strand, 52726847 - 52726384
Alignment:
| Q |
18 |
attggctaggttgaactttagctattttctctgcattgttccaattttatcagatatcccccaaggactgaactttagttattttgttaacaagnnnnnn |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52726847 |
attggctaggttgaactttagctattttctctgcattgttccaattttatcagatatcccctaaggactgaactttagttattttgttaacaagaaaaaa |
52726748 |
T |
 |
| Q |
118 |
n-tgtggttatgggtttctttttatactaaaaggttgtggtttttgaaattt-ggaatcccatttcacttcatggattgaaataatattttttggtggaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52726747 |
aatgtggttatgggtttctttttatactaa--ggttgtggtttttgaaattttggaatcacatttcacttcatggattgaaagaatattttttggtggaa |
52726650 |
T |
 |
| Q |
216 |
agattgatagaatttatgattagatattggtataattatcatgctttggctctgctgtaaataagcttcatgccttttcttgacagtaacttcatgcctt |
315 |
Q |
| |
|
|| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52726649 |
aggttgatagaatctatgattagatattggtataattatcatgctttggctctgctgtaaataagcttcatgccttttcttgacagtaacttcatgcctt |
52726550 |
T |
 |
| Q |
316 |
tgtcttgttgaaaattatggaatagtatatctatgtggccctgctgttttgtggcctaaaatccgtcaccaccaaatggtgacataggaaaaacttggag |
415 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52726549 |
tgtcttgttgaaaattatggcatagtatatctatgtggccctgctgttttgtggcctaaaatccgtcaccaccaaatggtgacataggaaaaacttggag |
52726450 |
T |
 |
| Q |
416 |
tcttttgcttttttagatagaatgtataaataatcactgatattggcaccccatccccctatagaa |
481 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52726449 |
tcttttgcttttttagatagaatgtataaataatcactgataatggcaccccatccccctatagaa |
52726384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University