View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14942_low_5 (Length: 408)
Name: NF14942_low_5
Description: NF14942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14942_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 3e-55; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 16 - 149
Target Start/End: Complemental strand, 8372209 - 8372076
Alignment:
| Q |
16 |
aagaagagacagaaacagttgtgccatgctatcacgccggaaacgattgcctcgccggaaacagcaaagatgacgacgacatagacgatgatccaacaaa |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8372209 |
aagaagagacagaaactgttgtgccatgatatcacgtcggaaacgattgcctcgccggaaacaacaaagatgacgacgacatagacgatgatccaacaaa |
8372110 |
T |
 |
| Q |
116 |
aatccaacaacccagaaattgaacacagtagtag |
149 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||| |
|
|
| T |
8372109 |
aatccaacaaaccataaattgaacacagtagtag |
8372076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 209 - 302
Target Start/End: Complemental strand, 8372016 - 8371923
Alignment:
| Q |
209 |
cgaatcacaacccaatcactttgattttgcgaatgagcttcggttgcacaaatggaaattgagaagaaaggaacgaagaatgtaaaaaagaggg |
302 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8372016 |
cgaatcgcaacccaatcactttgattttgcaaatgagcttcagttgcacaaatggaaattgagaagaaaggaacgaagaatgtaaaaaataggg |
8371923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 365 - 393
Target Start/End: Complemental strand, 8371860 - 8371832
Alignment:
| Q |
365 |
aatgatgtttgtgtttaaaaataaattaa |
393 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8371860 |
aatgatgtttgtgtttaaaaataaattaa |
8371832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 64; Significance: 7e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 211 - 302
Target Start/End: Complemental strand, 45048436 - 45048345
Alignment:
| Q |
211 |
aatcacaacccaatcactttgattttgcgaatgagcttcggttgcacaaatggaaattgagaagaaaggaacgaagaatgtaaaaaagaggg |
302 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||||||||||||||||||||||| || ||||| |||| |
|
|
| T |
45048436 |
aatcacaacccaatcactttgattttgtgaatgagcttcagttgcaggaatggaaattgagaagaaaggaacgaagaaggtgaaaaaaaggg |
45048345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 110 - 142
Target Start/End: Complemental strand, 45048531 - 45048499
Alignment:
| Q |
110 |
aacaaaaatccaacaacccagaaattgaacaca |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45048531 |
aacaaaaatccaacaacccagaaattgaacaca |
45048499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University