View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14942_low_9 (Length: 320)
Name: NF14942_low_9
Description: NF14942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14942_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 66 - 314
Target Start/End: Original strand, 12295508 - 12295756
Alignment:
| Q |
66 |
tatatacactgtttactatcgtttaagaatcattgtttactaaaattaggccatttttagaggttttaagacggcttccgacttgaaggttaattttttg |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12295508 |
tatatacactgtttactatcgtttaagaatcattgtttactaaaattaggccgtttttagaggttttaagacggcttccgacttgaaggttaattttttg |
12295607 |
T |
|
| Q |
166 |
aaaagtttttagttgcagtaaatgttgatcaaaggtttttggaaatagcgtgtgatttcttaaattgtgctcaaagagttatttcgtttaattacttggg |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12295608 |
aaaagtttttagttgcagtaaatgttgatcaaaggtttttggaaatagcgtgtgatttcttaaattgtgctcaaagagttatttcgtttaattacttggg |
12295707 |
T |
|
| Q |
266 |
gttaccggggtaaatccgaggaagatctctacgtgggagcctatgttac |
314 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12295708 |
gctaccggggtaaatccgaggaagatctctacgtgggagcctatgttac |
12295756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University