View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14943_high_26 (Length: 242)
Name: NF14943_high_26
Description: NF14943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14943_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 6387235 - 6387010
Alignment:
| Q |
1 |
tcaaatgtactatttggttagattttaattctcttttgttcaaaattggattccaattgtaacactaccacattgacattcaatttgtgcaatactgatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6387235 |
tcaaatgtactatttggttagattttaattctcttttgttcaaaattggattccaattgtaacactagcacattgacattcaatttgtgcaatactgatt |
6387136 |
T |
 |
| Q |
101 |
tatgcaatttgtaggcagcaaaattaatgttgcaatccatgctcatgcatactcaaacataaagatgc--nnnnnnnnatcaaaacatgtaatgtaagcc |
198 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6387135 |
tatgcaatttgtaggcagcaaaattcatgttgcaatccatgctcatgcatactcaaacataaagatgcttttttttttatcaaaacatgtaatgtaagcc |
6387036 |
T |
 |
| Q |
199 |
tttgaagcctaacaaaatgaatcaaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
6387035 |
tttgaagcctaacaaaatgaatcaaa |
6387010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University