View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14943_low_24 (Length: 247)
Name: NF14943_low_24
Description: NF14943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14943_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 9 - 229
Target Start/End: Original strand, 8655610 - 8655830
Alignment:
| Q |
9 |
ataatactaaaatttgaagttcccattttgaccaaatttattttgttcttgaagatccgcatgcaaataacattggcgagtgtgtgaaattgaagataag |
108 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8655610 |
ataatactaaaattagaagttcccattttgacgaaatttattttgttcttgaagatccgcatgcaaataacattggcgagtgtgtgaaattgaagataag |
8655709 |
T |
 |
| Q |
109 |
acgaagaagaaaaatgcacttgagcgagaatgaaggaattgaggggaagagcttcgtagtgaccggtggacttggattcgtaggatctgctctctgcttg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8655710 |
acgaagaagaaaaatgcacttgagcgagaatgaaggaattgaggggaagagcttcgtagtgaccggtggacttggattcgtaggatctgctctctgcttg |
8655809 |
T |
 |
| Q |
209 |
gaactcattagaagaggtgct |
229 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
8655810 |
gaactcattagaagaggtgct |
8655830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University