View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14944_high_18 (Length: 324)
Name: NF14944_high_18
Description: NF14944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14944_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 995698 - 995485
Alignment:
| Q |
18 |
aaacacaaacgttcctccacaacccaattaccaacagcatgaatatgtagccttttgattggaacttaacataaacacgaattgtgccaattcctccaaa |
117 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||| |
|
|
| T |
995698 |
aaacacaaacgttcctccgcaacccaattaccaacagcatgaatatgtagccttttgattggaacttcaaaaaaacacgaattgtgccaattcctccaaa |
995599 |
T |
 |
| Q |
118 |
ataacccccctagaacggctccatcacaaatgctaattctttacaaatacaacagcaactcgatgaagaatgaccaacacatcataagtgatatctaatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
995598 |
ataacccccctagaacggctccatcacaaatgctaattctttacaaatacaacagcaactcgatgaagaatgaccaacacatcataagtgacatctaatt |
995499 |
T |
 |
| Q |
218 |
cagttgtctgcatt |
231 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
995498 |
cagttgtctccatt |
995485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 267 - 310
Target Start/End: Complemental strand, 995491 - 995448
Alignment:
| Q |
267 |
ctccatttccactcattaatttgtacagtaacatcgtcaaatat |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
995491 |
ctccatttccactcattaatttgtacagtaacatcgtcaaatat |
995448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University