View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14944_low_31 (Length: 266)
Name: NF14944_low_31
Description: NF14944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14944_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 19 - 248
Target Start/End: Original strand, 6975012 - 6975249
Alignment:
| Q |
19 |
tatgaagctgttatttgaagctttttgatggacgcacannnnnnnnct--ttcaccactaaagcaaacacaacatatatgtattgtggannnnnnn---- |
112 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| || |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6975012 |
tatgaagctgttatttgaagttttttgatggacgcacattttttttctctttcaccgctaaagcaaacacaacatatatgtattgtggattttgtttttt |
6975111 |
T |
 |
| Q |
113 |
----atcatgttggattaaagaacaaatattgaaatattatcctgaaaattgtataatctactttttaaaagttaaaaagaaatgtttttgatgcaaagt |
208 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6975112 |
ttttatcatgatggattaaagaacaaatatagaaatattatcctgaaaattgtataatctactttttaaaagttaaaaagaaatgtttttgatgcaaagt |
6975211 |
T |
 |
| Q |
209 |
ttagttgtaaaccatttatatgtcttattctgtttgaagt |
248 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6975212 |
ttagttgtaaaccatt--tatgtcttattctgtttgaagt |
6975249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 142 - 187
Target Start/End: Original strand, 31820733 - 31820778
Alignment:
| Q |
142 |
aatattatcctgaaaattgtataatctactttttaaaagttaaaaa |
187 |
Q |
| |
|
||||||||| | ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
31820733 |
aatattatcttcaaaattgtatattctactttttaaaagttcaaaa |
31820778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University