View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14944_low_36 (Length: 242)
Name: NF14944_low_36
Description: NF14944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14944_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 27385303 - 27385526
Alignment:
| Q |
1 |
tttgacctcgaaaaactgaagtctcatgtaacccttcttgaagaggataaagggaaactcatgattaagatacaagagttgtgaaatgactagctagaga |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27385303 |
tttgaccccgaaaaactgaagtctcatgtaacccttcttgaagaggataaaggaaaactcatgattaagatacaggagttgtgaaatgactagctagaga |
27385402 |
T |
|
| Q |
101 |
aatagtcaaaaaggattgggagaggagattaagttcatagataaggatcgggaggagttcgcgacattgtagtctgcgatggattattggatggttgaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27385403 |
aatagtcaaaaaggattgggagaggagattaagttcatagataaggatcgggcggagttcgccacattgtagtctgggatggattattggatggttgaga |
27385502 |
T |
|
| Q |
201 |
gaaggtatggtgcaaggccttcag |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
27385503 |
gaaggtatggtgcaaggccttcag |
27385526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University