View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14945_high_14 (Length: 306)
Name: NF14945_high_14
Description: NF14945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14945_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 21 - 292
Target Start/End: Complemental strand, 47706450 - 47706175
Alignment:
| Q |
21 |
aacaatagtgagtgattcatcatatactttaatcactttgtcaaaaaagaaatcttatctta----catacattaacgagttgggcaatgacttgacaag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47706450 |
aacaatagtgagtgattcatcatatactttaatcactttgttaaaaaagaaatcttattttatatacatacattaacgagttgggcaatgacttgacaag |
47706351 |
T |
 |
| Q |
117 |
tttacatcaattttttcttccatttgagtgatatgccttctcgtgcacggtggattattagtcccggaattgcacttgaaatcttcatcataaatattgc |
216 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47706350 |
tttacatcaattttttcttccttttgagtgatatgccttctcgtgcacggtggattattagtcccggaattgcacttgaaatcttcatcataaatattgc |
47706251 |
T |
 |
| Q |
217 |
tatgatgaacattaaaaaagtcaccattcttcacttttcacgcttgagaaggtccctttttggtatgggaccatat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47706250 |
tatgatgaacattaaaaaagtcaccattcttcactcttcacgcttgagaaggtccctttttggtatgggaccatat |
47706175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University