View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14945_low_18 (Length: 289)
Name: NF14945_low_18
Description: NF14945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14945_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 17 - 285
Target Start/End: Original strand, 50005413 - 50005681
Alignment:
| Q |
17 |
acacagaagcaaggtggacccttaaaccgtgacgattttctcactcgaaatgatgtgcgcaacatggaaaggactattcataattcttcacgtgagctac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50005413 |
acacagaagcaaggtggacccttaaaccgtggcgattttctcactcgaaatgatgtgcgcaacatggaaaggactattcataattcttcacgtgagctac |
50005512 |
T |
 |
| Q |
117 |
tgggaaatgaagaatgcagtgtaaagatatggattcagcgtcatcagaaggacgttttctatttccaagataactcaggctcagaatcttttattgtggc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50005513 |
tgggaaatgaagaatgcagtgtaaagatatggattcagcgtcatcagaaggacattttctatttccaagataactcaggctcagaatcttttattgtggc |
50005612 |
T |
 |
| Q |
217 |
tatacagacagattggcagctgcaacaaatgcttcgttatgaaagtaatagtttcatttcttttcactc |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50005613 |
tatacagacagattggcagctgcaacaaatgcttcgttatggaagtaatagtttcatttcttttcactc |
50005681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University