View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14945_low_20 (Length: 255)
Name: NF14945_low_20
Description: NF14945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14945_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 41548706 - 41548465
Alignment:
| Q |
1 |
tcttagttcttttgtatagtaactgggacatcaaatcacatgtgtatggtaccattcnnnnnnnatcaataggaaccgaac--gatattc---gagttta |
95 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||| | ||||||| |
|
|
| T |
41548706 |
tcttagttcttttgtatagtgattgggacatcaaatcacatgtgtatggtacgattctttttttatcaataggaaccgaactcgatatcccaagagttta |
41548607 |
T |
 |
| Q |
96 |
caacagtcacacacttggctccatgcaagagtgtgttcctttaagatctgggaacataaatgccaacatagccaacccccacaacaaagaaggcaataga |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41548606 |
caacagtcacacacttggctccatgcaagagtgtgttcctctaagatctgggaacatagatgccaacatagccaacccccacaacaaagaaggcaataga |
41548507 |
T |
 |
| Q |
196 |
ttgcaggaaaagatatatatagcactgattcttcccaaaggc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41548506 |
ttgcaggaaaagatatatatagcactgattcttcccaaaggc |
41548465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University