View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14945_low_21 (Length: 253)
Name: NF14945_low_21
Description: NF14945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14945_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 14 - 222
Target Start/End: Complemental strand, 41549058 - 41548846
Alignment:
| Q |
14 |
cataggataggtattgcctcttactcttgggccttagcaaagatatagtaatatcttccctagcaatgtgtttgt-atctttgaacaacaagttcgaact |
112 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || ||||||| | |
|
|
| T |
41549058 |
cataggataggtattgcctctaactcttaggccttagcaaagatatagtaatatcttccctagcaatgtgtttgtgatctttgaacagcaggttcgaatt |
41548959 |
T |
 |
| Q |
113 |
tcgaaggcttg---gaatcagaagatcgtagaggcttatatgaatcttcctatatttccttgttatatgaatcataagaatgtgctttatttttgttgtt |
209 |
Q |
| |
|
|| |||||||| |||||||||||||| ||||||||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41548958 |
tccaaggcttgttggaatcagaagatcgcagaggcttatatgaatctttctatatttccttattatatgaatcataagaatgtggtttatttttgttgtt |
41548859 |
T |
 |
| Q |
210 |
gacaatatcataa |
222 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41548858 |
gacaatatcataa |
41548846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University