View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14945_low_24 (Length: 226)
Name: NF14945_low_24
Description: NF14945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14945_low_24 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 2624413 - 2624188
Alignment:
| Q |
1 |
aaaatgtgacggacaacttcgccatctgactaattctttacaatggaagaaacttcatgaattgcatatggattttgggactaagtcaagaaaccatatg |
100 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2624413 |
aaaatgtgacggtcaacttcgtcatctgactaattctttacaatggaaaaaacttcatgaattgtatatggattttgggactaagtcaagaaaccatatg |
2624314 |
T |
|
| Q |
101 |
cttgaatttgctacatattgaataaatcgatatatgcaaatttaatagtaacatagttcatggcccattctcccaatatatgcaaatatattatgttatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2624313 |
cttgaatttgctacatattgaataaatcgatatatgcaaatttaatagtaacatagttcatggcccattctcccaatatatgcaaatacattatgttatc |
2624214 |
T |
|
| Q |
201 |
tatgatgattttgggtctaagacaac |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2624213 |
tatgatgattttgggtctaagacaac |
2624188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University