View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14946_high_6 (Length: 298)
Name: NF14946_high_6
Description: NF14946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14946_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 9e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 164 - 296
Target Start/End: Complemental strand, 9581151 - 9581019
Alignment:
| Q |
164 |
gagcgagattaacaatagtccaagcaatcccaggagaacaaccaaagacagacaaaaccatgatccatgaaaagaagaggatgagaatatatgttgtcca |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9581151 |
gagcgagattaacaatagtccaagcaatcccaggagaacaaccaaagacagacaaaaccatgatccatgaaaagaagaggatgagaatatatgttgtcca |
9581052 |
T |
 |
| Q |
264 |
aacaccaggatacgtaaaccattctgtgctcct |
296 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
9581051 |
aacaccaggatacgtaaaccattctgtgttcct |
9581019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University