View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14946_high_7 (Length: 277)

Name: NF14946_high_7
Description: NF14946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14946_high_7
NF14946_high_7
[»] chr1 (1 HSPs)
chr1 (16-261)||(6635150-6635395)
[»] chr3 (1 HSPs)
chr3 (21-253)||(52164053-52164285)
[»] chr5 (1 HSPs)
chr5 (191-261)||(15964383-15964453)


Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 16 - 261
Target Start/End: Complemental strand, 6635395 - 6635150
Alignment:
16 atgcagttttggcagcaccagagtattgcaatgcaaatttcacattttacttcacaccaacattttggtccaacccatctttgtctttaacattcacgaa 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
6635395 atgcagttttggcagcaccagagtattgcaatgcaaatttcacattttacttcacaccaacattttggtccaacccatctttgtctttaacattcgcgaa 6635296  T
116 tcgaaaagcttgttactttaataccggggttatggtaattgatctagaaaaatggcgcgacggagattacacaacaaagattgaggaatggatggaatta 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6635295 tcgaaaagcttgttactttaataccggggttatggtaattgatctagaaaaatggcgcgacggagattacacaacaaagattgaggaatggatggaatta 6635196  T
216 caaaagaggatgagaatctatgaacttggttcattgccaccttttt 261  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
6635195 caaaagaggatgagaatctatgaacttggttcattgccaccttttt 6635150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 21 - 253
Target Start/End: Complemental strand, 52164285 - 52164053
Alignment:
21 gttttggcagcaccagagtattgcaatgcaaatttcacattttacttcacaccaacattttggtccaacccatctttgtctttaacattcacgaatcgaa 120  Q
    ||||| |||||||| || ||||| || ||||||||||  | ||| || || ||| | |||||||| || || ||||||||| | || ||  |||||||||    
52164285 gttttagcagcacctgaatattgtaacgcaaatttcagttcttattttactccatcgttttggtctaatccttctttgtctctcacttttgcgaatcgaa 52164186  T
121 aagcttgttactttaataccggggttatggtaattgatctagaaaaatggcgcgacggagattacacaacaaagattgaggaatggatggaattacaaaa 220  Q
    |  ||||||| || || || || || ||||| |||||| | |||  |||| | || || ||||| ||  ||||||||||||| |||||||| || || ||    
52164185 agccttgttatttcaacacgggtgtgatggtgattgatttggaacgatggagagaaggggattatactgcaaagattgaggattggatggagttgcagaa 52164086  T
221 gaggatgagaatctatgaacttggttcattgcc 253  Q
    ||||||||| ||||||||| | ||||| |||||    
52164085 gaggatgaggatctatgaattgggttcgttgcc 52164053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 191 - 261
Target Start/End: Complemental strand, 15964453 - 15964383
Alignment:
191 aaagattgaggaatggatggaattacaaaagaggatgagaatctatgaacttggttcattgccaccttttt 261  Q
    |||||||||  | |||||||| |||||||||| ||  ||||||||||| || |||||||||||||||||||    
15964453 aaagattgaaaactggatggagttacaaaagaagagaagaatctatgagctaggttcattgccaccttttt 15964383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University