View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14946_low_7 (Length: 277)
Name: NF14946_low_7
Description: NF14946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14946_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 16 - 261
Target Start/End: Complemental strand, 6635395 - 6635150
Alignment:
| Q |
16 |
atgcagttttggcagcaccagagtattgcaatgcaaatttcacattttacttcacaccaacattttggtccaacccatctttgtctttaacattcacgaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6635395 |
atgcagttttggcagcaccagagtattgcaatgcaaatttcacattttacttcacaccaacattttggtccaacccatctttgtctttaacattcgcgaa |
6635296 |
T |
 |
| Q |
116 |
tcgaaaagcttgttactttaataccggggttatggtaattgatctagaaaaatggcgcgacggagattacacaacaaagattgaggaatggatggaatta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6635295 |
tcgaaaagcttgttactttaataccggggttatggtaattgatctagaaaaatggcgcgacggagattacacaacaaagattgaggaatggatggaatta |
6635196 |
T |
 |
| Q |
216 |
caaaagaggatgagaatctatgaacttggttcattgccaccttttt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6635195 |
caaaagaggatgagaatctatgaacttggttcattgccaccttttt |
6635150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 21 - 253
Target Start/End: Complemental strand, 52164285 - 52164053
Alignment:
| Q |
21 |
gttttggcagcaccagagtattgcaatgcaaatttcacattttacttcacaccaacattttggtccaacccatctttgtctttaacattcacgaatcgaa |
120 |
Q |
| |
|
||||| |||||||| || ||||| || |||||||||| | ||| || || ||| | |||||||| || || ||||||||| | || || ||||||||| |
|
|
| T |
52164285 |
gttttagcagcacctgaatattgtaacgcaaatttcagttcttattttactccatcgttttggtctaatccttctttgtctctcacttttgcgaatcgaa |
52164186 |
T |
 |
| Q |
121 |
aagcttgttactttaataccggggttatggtaattgatctagaaaaatggcgcgacggagattacacaacaaagattgaggaatggatggaattacaaaa |
220 |
Q |
| |
|
| ||||||| || || || || || ||||| |||||| | ||| |||| | || || ||||| || ||||||||||||| |||||||| || || || |
|
|
| T |
52164185 |
agccttgttatttcaacacgggtgtgatggtgattgatttggaacgatggagagaaggggattatactgcaaagattgaggattggatggagttgcagaa |
52164086 |
T |
 |
| Q |
221 |
gaggatgagaatctatgaacttggttcattgcc |
253 |
Q |
| |
|
||||||||| ||||||||| | ||||| ||||| |
|
|
| T |
52164085 |
gaggatgaggatctatgaattgggttcgttgcc |
52164053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 191 - 261
Target Start/End: Complemental strand, 15964453 - 15964383
Alignment:
| Q |
191 |
aaagattgaggaatggatggaattacaaaagaggatgagaatctatgaacttggttcattgccaccttttt |
261 |
Q |
| |
|
||||||||| | |||||||| |||||||||| || ||||||||||| || ||||||||||||||||||| |
|
|
| T |
15964453 |
aaagattgaaaactggatggagttacaaaagaagagaagaatctatgagctaggttcattgccaccttttt |
15964383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University