View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14947_low_8 (Length: 264)
Name: NF14947_low_8
Description: NF14947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14947_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 16128596 - 16128828
Alignment:
| Q |
18 |
tccgtatcttgttgagttgcttggaagtgaggattggactgtgaggaaagcctcggcggaggcgttggggaaggtagcgtcggtagagagagattttgcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16128596 |
tccgtatcttgttgagttgcttggaagtgaggattggactgtgaggaaagcctcggcggaggcgttggggaaggtagcgtcggtagagagagattttgcg |
16128695 |
T |
 |
| Q |
118 |
acgcagcataaggttctgtgtttggagtcgttgcaaaatcgaaggtttgataaggtaatttgttattactactttttcttaaatttgattttagtctatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16128696 |
acgcagcataaggttctgtgtttggagtcgttgcaaaatcgaaggtttgataaggtaatttgttattactactttttcttaaatatgattttagtctatg |
16128795 |
T |
 |
| Q |
218 |
ttaggtaatttgttgttattatttcttatttaa |
250 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
16128796 |
ttaggtaatttgttgttattatttcttgtttaa |
16128828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University