View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14948_high_11 (Length: 231)
Name: NF14948_high_11
Description: NF14948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14948_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 5 - 171
Target Start/End: Complemental strand, 22081056 - 22080890
Alignment:
| Q |
5 |
gagaaaagtgaaagaagggcgtgaagagggaaatgagggaaatctgcagaaagattttcaaaaggtttttgaaaaagcatatgtcacttccttgggggaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22081056 |
gagaaaagtgaaagaagggcgtgaagagggaaatgagggaaatctgcagaaagattttcaaaaggtttttgaaaaagcatatgtcacttccttgggggaa |
22080957 |
T |
 |
| Q |
105 |
gtgggttgtacttctgcagagaaggtctactccttaaacttattaaccttccaaacacacttcaaga |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||| |||||||||||||||| |
|
|
| T |
22080956 |
gtgggttgtacttctgcagagaaggtctactgcctaaacttattaaccttgcaaacacacttcaaga |
22080890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 39 - 115
Target Start/End: Original strand, 1521837 - 1521913
Alignment:
| Q |
39 |
gagggaaatctgcagaaagattttcaaaaggtttttgaaaaagcatatgtcacttccttgggggaagtgggttgtac |
115 |
Q |
| |
|
||||||||||| |||||||||||| ||| || ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1521837 |
gagggaaatcttcagaaagattttgaaatggctttggaaaaagcatatgtcacttccttgggggaagtgggttgtac |
1521913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University