View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14948_high_6 (Length: 313)
Name: NF14948_high_6
Description: NF14948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14948_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 17 - 302
Target Start/End: Original strand, 12182011 - 12182296
Alignment:
| Q |
17 |
cacattgggagttggaaattgatatccattccatgtgagcaatccttcaannnnnnnaccacattttgctctaactttatacacatattaactaaaaaac |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12182011 |
cacatcgggagttggaaattgatatccattccatgtgagcaatccttcaatttttttaccacattttgctctaactttatacacatattaactaaaaaac |
12182110 |
T |
 |
| Q |
117 |
aggattaagccttgggtctagggccatatggctcttttccatgtgctataaatgactttacttctaagggtaatgcaatttgttcaatccattggccttc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12182111 |
aggattaagccttgggtctagggccatatggctcttttccatgtgctataaatgactttacttctaagggtaatgcaatttgttcaatccattggccttc |
12182210 |
T |
 |
| Q |
217 |
atttagggaatcatttagagatcctatgtcattgcctttaggtgtatttcaagttcaagaaaagccatatatagtcttttgttcat |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12182211 |
atttagggaatcatttagagatcctatgtcattgcctttaggtgtatttcaagttcaagaaaagccatatatagtcttttgttcat |
12182296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University