View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14948_low_11 (Length: 237)
Name: NF14948_low_11
Description: NF14948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14948_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 51937164 - 51937389
Alignment:
| Q |
1 |
tctgccggatgaaatcctctgtcatattctctcatatctt----ccagccaaagactcttttattacttgttttccttctgctaaatggaagcctctttg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51937164 |
tctgccggatgaaatcctctgtcatattctctcatatctttcttccagccaaagactcttttattacttgttttccttcagctaaatggaagcctctttg |
51937263 |
T |
|
| Q |
97 |
gcttttagttcccaaatccaatctagtcgatgatgatcaatgattcatcaaaagtgacaaacgctattctagctttaagtatacggtatttgtagccatt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51937264 |
gcttttagttcccaaatccaatctagtcgatgatgatcaatgattcatcaaaagtgacaaacgctattctagctttaagtatacggtatttgtagccatt |
51937363 |
T |
|
| Q |
197 |
aaccacacggaaatggcgccaattct |
222 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
51937364 |
aaccacacggaaatggcgccaattct |
51937389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University