View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14948_low_3 (Length: 411)
Name: NF14948_low_3
Description: NF14948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14948_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 20461080 - 20461357
Alignment:
| Q |
1 |
tccaaatgatcaatgctgtttatttgtttgcaaccgtagtatggttcaaacctctatttataggacttgttttaagactagcttaggaaataattgattt |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20461080 |
tccaaatgatcgatgctgtttatttgtttgcaaccgtagtatggttcaaacctctatttataggacttgttttaagactagcttaggaaataattgattt |
20461179 |
T |
|
| Q |
101 |
gtatatgtaagacatggttcatgttttatttaaatattcaacaatgatatttaaacaatataaattttcaaacactgatttaacaccgtattttatctat |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |||||||||||| |
|
|
| T |
20461180 |
gtatctgtaagacatggttcatgttttatttaaatattcaacaatgatatttaaacaatataaattttcaaacactggttcaacaccttattttatctat |
20461279 |
T |
|
| Q |
201 |
ctcttttatgttactataaattgtcagtctatcatatttttcaaatcactttctcttatctcttcaggtgtccacaaa |
278 |
Q |
| |
|
||||||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20461280 |
ctcttttatgttagtataaatcgtcagtttatcatatttttcaaatcactttctcttatctcttcaggtatccacaaa |
20461357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 370 - 411
Target Start/End: Original strand, 20461701 - 20461742
Alignment:
| Q |
370 |
gttttcagaccttgcaaatatatgactatttgtcttttgtct |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20461701 |
gttttcagaccttgcaaatatatgactatttgtcttttgtct |
20461742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University