View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14949_high_4 (Length: 432)
Name: NF14949_high_4
Description: NF14949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14949_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 10 - 416
Target Start/End: Complemental strand, 29624944 - 29624540
Alignment:
| Q |
10 |
ggttgagcacctgtcatcagggtcaattgcccagtcaacatcacaaaaagggtctgagagatggttgtctgttaactagggcaagagtggcacaaaggcc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29624944 |
ggttgagcacctgtcatcagggtcaattgcccagtcaacatcacaaa--gggtctgagagatggttgtctgttaactagggcaagagtggcacaaaggcc |
29624847 |
T |
 |
| Q |
110 |
aagatgcatagtgcctttcagatagtgtatgatgcgtttgactgccatccgatgagaatctaagcgattggccatgaactggcaaaccttattgactgct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29624846 |
aagatgcatagtgcctttcagatagtgtatgatgcgtttgactgccatccgatgagaatccaagcgattggccatgaactggcaaaccttattgactgct |
29624747 |
T |
 |
| Q |
210 |
aaggaaatttcagaacatgtgatgtgatggttgcattttaaagggcaccaaccacaaatctaaacatgaaaggaaattccaacctctccctcttctacaa |
309 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| ||||||| ||| |
|
|
| T |
29624746 |
aaggaaatttcaggacatgtgatgtgatggttgcattttaaagggcaccagccacaaatctaaacatgaaaggaaattccaacccctctctcttctgcaa |
29624647 |
T |
 |
| Q |
310 |
atcacgttccaaggtctctttcagcaactcaccttcaacctctcactcttcaaacgtcacattttaatatctccttcaacattcatctttatcagttctt |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29624646 |
atcacgttccaaggtctctttcagcaactcaccttcaacctctcactcttcaaacgtcacattttaatctctccttcaacattcatctttatcagttctt |
29624547 |
T |
 |
| Q |
410 |
tggtttc |
416 |
Q |
| |
|
||||||| |
|
|
| T |
29624546 |
tggtttc |
29624540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University