View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1494_high_11 (Length: 290)
Name: NF1494_high_11
Description: NF1494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1494_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 23 - 187
Target Start/End: Original strand, 17996194 - 17996358
Alignment:
| Q |
23 |
tgatggaacagttcccctataaaggcccactgcaaatagtccagcatatcctccgatggaagaatttccaatgttggagaaaccccattcataaccggaa |
122 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||| ||||| |||| |||||||| ||||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
17996194 |
tgatggaacagttcccccataaaggtccactgcaaatagtctagcatctccttcgatggaacaatttccaatgttggagcaaccccattcaaaatcggaa |
17996293 |
T |
 |
| Q |
123 |
aattatccttctccaacgtcaacgcatttttgaacgatttccccggagtagcggtgacgccaaag |
187 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17996294 |
aattatccttttccaacgtcaacgcatttttgaacgatttccccggagtagcggtgacgccaaag |
17996358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University