View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1494_low_7 (Length: 361)
Name: NF1494_low_7
Description: NF1494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1494_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 92 - 345
Target Start/End: Original strand, 3854264 - 3854519
Alignment:
| Q |
92 |
gtaatttaatagtgtgacttctagtcttgaactttatcaccga--tcaaaacacacacaatcnnnnnnnnatgtgtattctcaaaaaagcttgtgcatta |
189 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3854264 |
gtaatttaataatgtgacttctagtcttaaactttatcactgacatcaaaacacacacaatcttttttttatgtgtattctcaaaaaagcttgtgcatta |
3854363 |
T |
|
| Q |
190 |
aagaccttgcacaatagaattcaatagaagttttgcctatttaatgaacgctttaggaattttgcctagaatttaatagaaagttgtcacacctccacct |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||| || || | |
|
|
| T |
3854364 |
aagaccttgcacaatagaattcaatagaagttttgcctatttaatgaatgctctaggaattttgcctagaattcaatagaaagttgtcacacttctacat |
3854463 |
T |
|
| Q |
290 |
ttacaaatgtgaggttttcaagagtattcatatagttgactacttcactccatata |
345 |
Q |
| |
|
| |||||||| ||||| |||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
3854464 |
tcacaaatgtaaggttatcaagagtattcatatagttaactacttcactctatata |
3854519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University