View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14950_low_6 (Length: 207)
Name: NF14950_low_6
Description: NF14950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14950_low_6 |
 | |
|
| [»] scaffold0005 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0005 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 17 - 131
Target Start/End: Complemental strand, 228803 - 228689
Alignment:
| Q |
17 |
cactatgcatatgctttaactatcttgaccaggaaaagatacgagttgctctttatgtacaaaaagcagcattgcattttataaacggtaatctacattc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
228803 |
cactatgcatatgctttaactatcttgaccaggagaagatacgagttgctctttatgtacaaaaagcagcattgcattttataaacggtaatctacattc |
228704 |
T |
|
| Q |
117 |
aatagctttcattca |
131 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
228703 |
aatagctttcattca |
228689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 17 - 131
Target Start/End: Original strand, 14588575 - 14588689
Alignment:
| Q |
17 |
cactatgcatatgctttaactatcttgaccaggaaaagatacgagttgctctttatgtacaaaaagcagcattgcattttataaacggtaatctacattc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14588575 |
cactatgcatatgctttaactatcttgaccaggagaagatacgagttgctctttatgtacaaaaagcagcattgcattttataaacggtaatctacattc |
14588674 |
T |
|
| Q |
117 |
aatagctttcattca |
131 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
14588675 |
aatagctttcattca |
14588689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University