View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14951_high_10 (Length: 230)
Name: NF14951_high_10
Description: NF14951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14951_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 19 - 214
Target Start/End: Complemental strand, 25049392 - 25049195
Alignment:
| Q |
19 |
acattacatatagccggcttaggaatggttgcttctggccgtctgtgaaaccggctctcatgttatgagnnnnnnncttctttcttcctttgtcttttac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25049392 |
acattacatatagccggcttaggaatggttgcttctggccgtctgtgaaaccggctctcatgttatgagtttttttcttctttcttcctttgtcttttac |
25049293 |
T |
 |
| Q |
119 |
tcacaatt--gtgttatgtggctttcaaccggttttggaatctgtttgatgtatctgtgactctcttattatataacttcattcaccttttcctctgt |
214 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25049292 |
tcacaattttgtgttatgtggctttcaaccggttttggaatctgtttgatgtatctgtgactctcttattatataacttcattcaccttttcctctgt |
25049195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University