View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14951_low_10 (Length: 230)
Name: NF14951_low_10
Description: NF14951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14951_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 27 - 191
Target Start/End: Original strand, 47116867 - 47117030
Alignment:
| Q |
27 |
taataacgtgtggtttctttgtcttacaatttattgacatgaaataatatcttttcagtacaggg-ttgagtatgtaagtcttcttcctagatcatccaa |
125 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47116867 |
taataacgtgcggtttctttgtcttac--tttattgacatgaaataatatcttttcagcacaggggttgagtatgtaagtcttcttcctagatcatccaa |
47116964 |
T |
|
| Q |
126 |
tattattattacccaaaaattgtagagggtgagatatataacaacaaaaacttccaagaagagatg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
47116965 |
tattattattacccaaaaattgtagagggtgacatatataacaacaaaaactttcaagaagagatg |
47117030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University