View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14951_low_12 (Length: 229)
Name: NF14951_low_12
Description: NF14951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14951_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 11 - 213
Target Start/End: Complemental strand, 40687149 - 40686947
Alignment:
| Q |
11 |
gagatgaattaaaggaaagtataggaagcaataagctaggtagccattactttggctcaacgatttgtgcacgagatgattaattggagtgcaagcctgg |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40687149 |
gagattaattaaaggaaagtataggaagcaataagctaggtagccattactttggctcaacgatttgtgcacgagatgattaattggagtgcaagcctgg |
40687050 |
T |
|
| Q |
111 |
aaccacggaatctgcggtgatcccttcccttctattatgctacctttattttgtatgtactctgtcatgtctgcatcaccacacattttacattcgttcc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40687049 |
aaccacggaatctgcggtgatcccttcccttctattatgctacctttattttgtatgtactctgtcatgtctgcatcaccacacattttacattcgttcc |
40686950 |
T |
|
| Q |
211 |
atg |
213 |
Q |
| |
|
||| |
|
|
| T |
40686949 |
atg |
40686947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University