View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14951_low_4 (Length: 290)
Name: NF14951_low_4
Description: NF14951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14951_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 20 - 279
Target Start/End: Complemental strand, 43015081 - 43014824
Alignment:
| Q |
20 |
atgacagcactgcaattatcagttataagctcctagaaacttccttgttgcacttcgcaagcacacccccattccaagttttcgatcagctgagcatact |
119 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43015081 |
atgacagcactgcaattatcagttata-gctcctagaaacttccttgttgcacttcgcaagcacacccccattccaagttttcgatcagctgagcatact |
43014983 |
T |
 |
| Q |
120 |
gccatgcttgcagcaccctgtataactcagaccagtaaacataagattgaacaggcaatatgttacattataaatctctcatcatcgtcattattatgaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
43014982 |
gccatgcttgcagcaccctgtataactcagaccagtaaacatacgattgaacaggcaatatgttacattataaatttctcatcattgtcattattatgaa |
43014883 |
T |
 |
| Q |
220 |
aatccacatatttgcataacattaaatatttatacgatatataactcagtcctttgctac |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||||| |||||||| |
|
|
| T |
43014882 |
aatccacatatttgcataacattaaatatttatttgatatat-actcagtcttttgctac |
43014824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University