View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14951_low_5 (Length: 279)
Name: NF14951_low_5
Description: NF14951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14951_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 6 - 275
Target Start/End: Complemental strand, 5663390 - 5663121
Alignment:
| Q |
6 |
atgaagttcgtatacctataannnnnnngtcagaatacttagataatacaattaaattgtagtctgcaaatgcaattgcggctgcaatataaaattccta |
105 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5663390 |
atgaagttcgtatacctataatttttttgtcagaatacttagataatacaattaaattgtagtctgcaaatgcaattgcggctgcaatataaaattccta |
5663291 |
T |
 |
| Q |
106 |
gagatatctgcagtggtaatttcaaccgcatcttcttcatgtttttgcatggccatcctcgtgtactctttttcacatagcctaataggcttctccatgg |
205 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5663290 |
gaggtatctgcagtggtaatttcaaccgcatcttcttcatgtttttgcatggccatcctcgtgtactctttttcacatagcctaataggcttctccatgg |
5663191 |
T |
 |
| Q |
206 |
agatctgttttaccttctatgataaagttaaactcctttgttggaaatttgtattcaatctatccctatg |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5663190 |
agatctgttttaccttctatgataaagttaaactcctttgttggaaatttgtattcaatctatctctatg |
5663121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University