View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14951_low_9 (Length: 244)
Name: NF14951_low_9
Description: NF14951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14951_low_9 |
 |  |
|
| [»] scaffold0092 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0092 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: scaffold0092
Description:
Target: scaffold0092; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 6 - 234
Target Start/End: Original strand, 22389 - 22616
Alignment:
| Q |
6 |
agcagcagagacaaaaattcaaagtcatgtacaagaggaagctatatcctcatggaaagtttgggaacctcctgatccaacaaggaggtccatgaaaacc |
105 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22389 |
agcatcagagacaaaaattcaaagtcatgtacaagaggaagctatatcctcatggaaagtttgggaacctcctgatcgaacaaggaggtccatgaaaacc |
22488 |
T |
 |
| Q |
106 |
aggtgataaatagaggatgtttatttaccnnnnnnnnnnaggatttcttgctatgaaactatgtgattggtctaggtcaaactatttacattttatatag |
205 |
Q |
| |
|
|||||| ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22489 |
aggtgaaaaatagaggatgttt-tttactttttttttttaggatttcttgctatgaaactatgtgattggtctaggtccaactatttacattttatatag |
22587 |
T |
 |
| Q |
206 |
ggattttatttaccatcactatgatgatg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22588 |
ggattttatttaccatcactatgatgatg |
22616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University