View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14952_high_5 (Length: 353)
Name: NF14952_high_5
Description: NF14952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14952_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 12 - 198
Target Start/End: Original strand, 42168942 - 42169128
Alignment:
| Q |
12 |
acagatgatattgctgaagaaatctcgttccagagctttgatgatgattgtaggttgcttggtaatcttctcaacgacattcttcatcgtgaagttggta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42168942 |
acagatgatattgctgaagaaatctcgttccagagctttgatgatgattgtaggttgcttggtaatcttctcaacgacattcttcatcgtgaagttggta |
42169041 |
T |
 |
| Q |
112 |
ccacctttgttgacaaactcgaaagaattcgtgtccttgctcaggtaactaaaaattcaaacttttctctttctcttcataccccac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42169042 |
ccacctttgttgacaaactcgaaagaattcgtgtccttgctcaggtaactaaaaattcaaacttttctctttctcttcataccccac |
42169128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 291 - 333
Target Start/End: Original strand, 42169174 - 42169216
Alignment:
| Q |
291 |
ttttcccccttgctgaatgtgaaaatctatgaagcactgacac |
333 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42169174 |
ttttcccccttgcttaatgtgaaaatctatgaagcactgacac |
42169216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University