View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14952_low_11 (Length: 253)
Name: NF14952_low_11
Description: NF14952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14952_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 7 - 243
Target Start/End: Complemental strand, 1485992 - 1485753
Alignment:
| Q |
7 |
aaaatcacgttttaactcgtataatgatttgatctcacatttttggatatgaatttcgagttaaatcgcttataaaattgaaac---gtaaaattggacc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
1485992 |
aaaatcacgttttaactcgtataatgatttgatctcacatttttggatatgaatttcaagttaaatcgcttataaaatcgaaactgagtaaaattggacc |
1485893 |
T |
 |
| Q |
104 |
tgaaccaccatggtattataaaactgcatagtctagcttttataaccaccaaaaatacccaacatgatcaactgtcatataaacacttaacatgctaact |
203 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1485892 |
tgaaccaccatggtattataaagctgcatagtctagcttttataaccaccaaaaatacccatcatgatcaactgtcatataaacacttaacgtgctaact |
1485793 |
T |
 |
| Q |
204 |
catgcagtgtgacagaaagcttaacaaaatatatatattg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1485792 |
catgcagtgtgacagaaagcttaacaaaatatatatattg |
1485753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University