View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14952_low_7 (Length: 307)
Name: NF14952_low_7
Description: NF14952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14952_low_7 |
 |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0194 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 79 - 291
Target Start/End: Complemental strand, 26454 - 26242
Alignment:
| Q |
79 |
tattacaacttctttcctagtttgtgtctaactctaaccattgtttaaaactttggtgcaatatagtgagctagaacatacaatttttcttgaagaaaat |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26454 |
tattacaacttctttcctagtttgtgtctaactctaaccattgtttaaaactttggtgcaatatagtgagctagaacatacaatttttcttgaagaaaat |
26355 |
T |
 |
| Q |
179 |
aaataaattaaaattaccctttgcacgtatgaaccaggcatgagggatctaagaacacgaagatgttcattcatttgtttccttcgattcctttcaacag |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26354 |
aaataaattaaaattaccctttgcacgtatgaaccaggcatgagggatctaagaacacgaagatgttcattcatttgtttccttcgattcctttcaacag |
26255 |
T |
 |
| Q |
279 |
ctatgtgagtcat |
291 |
Q |
| |
|
||||||||||||| |
|
|
| T |
26254 |
ctatgtgagtcat |
26242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University