View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14952_low_9 (Length: 294)
Name: NF14952_low_9
Description: NF14952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14952_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 103 - 279
Target Start/End: Complemental strand, 10661827 - 10661657
Alignment:
| Q |
103 |
tgtatcatattgtttaattgaaatattgaagggttcagcaatctgaaacatcgccgcaaaaccctttctctctacgaagagtcgagccgtctgtgtccac |
202 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10661827 |
tgtatcatattgtttaattgaaattttgaagggttcagcaatctgaaacatcgccgcaaaaccctttctctctacgaagagttgagccgtctgtgtccac |
10661728 |
T |
 |
| Q |
203 |
atcgccgccacccacccactgatcaccatcctatctgctgtcgccagctaccatcacgccgttccggtgagcaagat |
279 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10661727 |
atcgccgccacccacccac------cgatcctatcttctgtcgccagctaccatcacgccgttccggtgagcaagat |
10661657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University