View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14953_low_11 (Length: 243)
Name: NF14953_low_11
Description: NF14953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14953_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 12 - 225
Target Start/End: Complemental strand, 310179 - 309966
Alignment:
| Q |
12 |
caaaggtaaaatatatacctcttaccatttgttgtggtttttacaattgcaacaaaatagtgggatgtgaattagaccgagtgtgacttaacattttctg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
310179 |
caaaggtaaaatatatacctcttaccatttgtcatggtttttacaattgcaacaaaatagtgggatgtgaattagaccgagtatgacttaacattttctg |
310080 |
T |
|
| Q |
112 |
tttaaggtattttatgtgattaatcttgtttcttccagtcagggtcataagcaccgaatcaatagacaaagcaaatccaagaagcaaaagttgtctcaca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
310079 |
tttaaggtattttatgtgattaatcttgtttcttccagtcagggtcagaagcaccgaatcaatagacaaagcaaatccaagaagcaaaagttgtctcaca |
309980 |
T |
|
| Q |
212 |
aggagggcaagcat |
225 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
309979 |
aggagggcaagcat |
309966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University