View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14953_low_12 (Length: 233)
Name: NF14953_low_12
Description: NF14953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14953_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 2 - 217
Target Start/End: Complemental strand, 36903517 - 36903302
Alignment:
| Q |
2 |
ttattatcttcaacatcaactatcttctgttccaacgcgttgaattcatctacgatttctgatatcgcattcaatctcccatccctgattttaaaaaatt |
101 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36903517 |
ttattctcttcaatctcaactatcttctgttccaacgcgttgaattcgtctacgatttctgatatcgcattcaatctcccatccctgattttaaaaaatt |
36903418 |
T |
|
| Q |
102 |
taacaattaggttatgttttatttttccttgatgatttagcagaaatggttgaagaagtgagggtaacgaacgaacctgtcgagacagaaattgagaaga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36903417 |
taacaattaggttatgttttatttttccttgatgatttagcagaaatggttgaagaagtgagagtaacgaacgaacctgtcgagacagaaattgagaaga |
36903318 |
T |
|
| Q |
202 |
gctccaaggaaaaact |
217 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
36903317 |
gctccaaggaaaaact |
36903302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 54
Target Start/End: Original strand, 17479567 - 17479601
Alignment:
| Q |
20 |
actatcttctgttccaacgcgttgaattcatctac |
54 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17479567 |
actatcttctgttccaaggcgttgaattcatctac |
17479601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 203
Target Start/End: Original strand, 17480321 - 17480353
Alignment:
| Q |
171 |
aacgaacctgtcgagacagaaattgagaagagc |
203 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
17480321 |
aacgaacctgtccagacagaaattgagaagagc |
17480353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University