View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14955_low_4 (Length: 324)
Name: NF14955_low_4
Description: NF14955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14955_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 19 - 308
Target Start/End: Original strand, 29142746 - 29143035
Alignment:
| Q |
19 |
aaggtaaggatcctaaagaggtggcggaggatatcaaagttatgtcgtcgagatggggattcgtcagatttaaaatgctgcattgtttgtattatggaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29142746 |
aaggtaaggatcctaaagaggtggcggaggatatcaaagttatgtcgtcgagatggggattcgtcagattgaaaatgctgcattgtttgtattatggaga |
29142845 |
T |
|
| Q |
119 |
tgaggatccttatagttgtttgataagatgtatattttgttttggggctgcctgactttagtttgcttcggtggtctgcttttttctgtcatggttttgc |
218 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29142846 |
tggggatccttatagttgtttgataagatgtatattttgttttggggctgcctgactttagtttgcttcggtggtctgcttttttctgtcatggttttgc |
29142945 |
T |
|
| Q |
219 |
agtggtaatttcggactgttcagactgctagtttggcttctggtctctgcaagccggtgtgtgcatagcttcatgcagcttcttatactc |
308 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| ||||| ||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
29142946 |
agtggtaatttcggactgttctgactgctagtttggcttctggtttctgcgagctggtgtgtgcacagcttcatgcagcttcttatactc |
29143035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 204 - 286
Target Start/End: Complemental strand, 32958811 - 32958729
Alignment:
| Q |
204 |
ctgtcatggttttgcagtggtaatttcggactgttcagactgctagtttggcttctggtctctgcaagccggtgtgtgcatag |
286 |
Q |
| |
|
||||||||||||| |||| || |||| | ||||| ||||||||||||||||| |||| ||||| ||| ||||||| ||||| |
|
|
| T |
32958811 |
ctgtcatggttttagagtgttagtttcaggctgttgtgactgctagtttggcttatggtttctgcgagctggtgtgtacatag |
32958729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University