View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14955_low_6 (Length: 212)
Name: NF14955_low_6
Description: NF14955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14955_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 1253118 - 1252943
Alignment:
| Q |
1 |
ctattttattattctccactgtttaagggggaggagcaaaagaaattggatgtgatttctaatgaagtatttgtgaaggccttaatcagcagcggacgca |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1253118 |
ctattttattattcaccactgtttaagggggaggagcaaaagaaattggatgtgatttctaatgaagtatttgtgaaggccttaatcagcagcggacgca |
1253019 |
T |
 |
| Q |
101 |
cagtaagtctacctacacactcgataaattgatatgcattttatttggcattgttttgcctctgatataataaaatgcaa |
180 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1253018 |
cagtaagt----ctacacactcgattaattcatatgcattttatttggcattgttttgcctctgatatagtaaaatgcaa |
1252943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University