View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14955_low_7 (Length: 210)
Name: NF14955_low_7
Description: NF14955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14955_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 17 - 202
Target Start/End: Original strand, 39306754 - 39306940
Alignment:
| Q |
17 |
aagaaatgcaactagagatattgtttatagtat-gtgggtaaggcaaaaatcacacttcttgatcaggcttacctaggagagatatcctacttatctaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39306754 |
aagaaatgcaactagagatattgtttatagtatcgtgagtaaggcaaaaatcacacttcttgatcaggcttacctaggagagatatcctacttatctaaa |
39306853 |
T |
|
| Q |
116 |
atgaggagtgcaattgagaatacttcttacaatatgatgttagatnnnnnnnncagaaattgactataactttgatatttgatgatg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
39306854 |
atgaggagtgcaattgagaatacttcttacaatataatgttagataaaaaacacagaaattgactctaactttgatatttgatgatg |
39306940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 28 - 152
Target Start/End: Original strand, 39306546 - 39306673
Alignment:
| Q |
28 |
ctagagatattgtttatagtatg---tgggtaaggcaaaaatcacacttcttgatcaggcttacctaggagagatatcctacttatctaaaatgaggagt |
124 |
Q |
| |
|
|||||||||||||||||||||| || | | | ||| |||||||||||||| | |||||||| ||| | |||||||||||||| ||||| |||||||| |
|
|
| T |
39306546 |
ctagagatattgtttatagtatcgtttgtgcatgacaataatcacacttcttgcttaggcttacttagtaaagatatcctacttaactaaagtgaggagt |
39306645 |
T |
|
| Q |
125 |
gcaattgagaatacttcttacaatatga |
152 |
Q |
| |
|
||||||||||| ||||| ||||||||| |
|
|
| T |
39306646 |
gcaattgagaacacttcgcacaatatga |
39306673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University