View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14957_high_24 (Length: 260)
Name: NF14957_high_24
Description: NF14957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14957_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 246
Target Start/End: Original strand, 37664027 - 37664259
Alignment:
| Q |
14 |
aaaaacaaggatgttgtgctggataatattattgagtcgtggtgccgtgtttgcggaattggttgagatttaagtcaaataacatggattacgatatgaa |
113 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37664027 |
aaaaacaaggatattgtgttggataatattattgagtcgtggagcgttgtttgcgaaattggttgagatttaagtcaaagaacatggattacgatatgaa |
37664126 |
T |
|
| Q |
114 |
tcattgccacgtgaatcctagagcttgtcttggatgtgtggatttgtaagggtgatgttgaggataatgcgttcttagaactgggagcattttggctgct |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37664127 |
tcattgctacgtgaatcctagagcttgtcttggatgtgtggatttgtaagggtgatgttgaggataatgcgttcttagaactgggagcattttggctgct |
37664226 |
T |
|
| Q |
214 |
aaagcactttttgtgagattttggagttgtctg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37664227 |
gaagcactttttgtgagattttggagttgtctg |
37664259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 246
Target Start/End: Original strand, 37673749 - 37673981
Alignment:
| Q |
14 |
aaaaacaaggatgttgtgctggataatattattgagtcgtggtgccgtgtttgcggaattggttgagatttaagtcaaataacatggattacgatatgaa |
113 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37673749 |
aaaaacaaggatattgtgttggataatattattgagtcgtggagcgttgtttgcgaaattggttgagatttaagtcaaagaacatggattacgatatgaa |
37673848 |
T |
|
| Q |
114 |
tcattgccacgtgaatcctagagcttgtcttggatgtgtggatttgtaagggtgatgttgaggataatgcgttcttagaactgggagcattttggctgct |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37673849 |
tcattgctacgtgaatcctagagcttgtcttggatgtgtggatttgtaagggtgatgttgaggataatgcgttcttagaactgggagcattttggctgct |
37673948 |
T |
|
| Q |
214 |
aaagcactttttgtgagattttggagttgtctg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37673949 |
gaagcactttttgtgagattttggagttgtctg |
37673981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University