View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14957_high_28 (Length: 251)
Name: NF14957_high_28
Description: NF14957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14957_high_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 9 - 232
Target Start/End: Original strand, 12159727 - 12159950
Alignment:
| Q |
9 |
agcagagatggaaagccatagttttcattactaaaggcattgttttagatggtagtgatgatactttggagtattgatccattatttttcccattttaga |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12159727 |
agcaaagatggaaagccatagttttcattactaaagggattgttttagatggtagtgatgatactttggagtattgatccattatttttcccattttaga |
12159826 |
T |
 |
| Q |
109 |
taggtataattaatctggcccacactcatggccaacttgaattttgtttcatacgtataattttataattcaatagtaatagtaatagcttttattgtat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12159827 |
taggtataattaatctggcccacactcatggccaacttgaattttgtttcatacgtataattttataattcaatagtaatagtaatagcttttattatat |
12159926 |
T |
 |
| Q |
209 |
gaaccatagatacgaaagcagata |
232 |
Q |
| |
|
||| |||||||||| ||| |||| |
|
|
| T |
12159927 |
gaagtatagatacgacagcggata |
12159950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University