View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14957_low_19 (Length: 319)
Name: NF14957_low_19
Description: NF14957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14957_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 5e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 73 - 301
Target Start/End: Original strand, 33116098 - 33116313
Alignment:
| Q |
73 |
actgtcagctacaaatcatattgacttgactttatcccatgcatggcacttctttcgaagttgcaaccaacagcaatctttgacattcaccacttccact |
172 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33116098 |
actgtccgctacaaatcatattgacttgactttatcccatg----gcacttctttctaagttgcaaccaaca---atctttgacattcaccacttccact |
33116190 |
T |
 |
| Q |
173 |
cattacatacgtgcaactgcaagtgtgcaatgtgtgagtctaaatatctagggcagccctattttctagaggatgcttgtgaaaataaatttgattctat |
272 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33116191 |
cattacatacgtgca------agtgtgcaatgtgtgagtctaaatatctagggcagccctattttttagaggatgcttgtgaaaataaatttgattctat |
33116284 |
T |
 |
| Q |
273 |
catcctccttatcttattcatttagcatg |
301 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33116285 |
catcctccttatcttattcatttagcatg |
33116313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University