View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14957_low_28 (Length: 268)
Name: NF14957_low_28
Description: NF14957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14957_low_28 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 13715939 - 13716125
Alignment:
| Q |
1 |
ctttccatgtcctccatcacctttagttctggacttagtcggctgatatcttactcatacagctgagttgagggcaaacttgtacttgtacgactgagtg |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13715939 |
ctttccatgtcttccatcacctttagttctggacttagtcggctgatatcttactcatacagctgagttgagggcaaacttgtacttgtacgactgagtg |
13716038 |
T |
|
| Q |
101 |
cttggctagcatttactcatgttgtccacattcctatttttgagcaagtggatgttcaaccannnnnnnccattcaaattgatcttg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
13716039 |
cttggctagcatttactcatgttgtccacattcctatttttgagcaagtggatgttcgaccatttttttccattcaaattgatcttg |
13716125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 213 - 268
Target Start/End: Original strand, 9639082 - 9639137
Alignment:
| Q |
213 |
ctttaatcgcttcttttattatgtcacatatgtaggaaagtgattgtatagccttt |
268 |
Q |
| |
|
|||| ||| |||| ||||| |||||||||||||||||||||| |||||||| |||| |
|
|
| T |
9639082 |
ctttgatcacttcatttatcatgtcacatatgtaggaaagtggttgtatagtcttt |
9639137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University