View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14957_low_37 (Length: 221)
Name: NF14957_low_37
Description: NF14957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14957_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 13277422 - 13277624
Alignment:
| Q |
1 |
aatttcaatttccaacaacaaaaatctctttcatctctctgaactggaatagcagcaaattagagaatccatccttgatctcatctccctcttcgccaaa |
100 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
13277422 |
aatttcaatttccaacagcaaaattctctttcatctctctgaactggaatagcagcaaattagagaatccatcattgatctcatctccctcttcctcaaa |
13277521 |
T |
 |
| Q |
101 |
gaaattgttgtcggtggaggcttgttggggtttcttccatttcatagctgagaaataaagccatttcattgttgagaaataaagccataaatgattggtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13277522 |
gaaattgttgtcggtggaggcttgttggggtttcttcgatttcatagctgagaaataaagccatttcattgttgagaaataaagccataaatgattggtt |
13277621 |
T |
 |
| Q |
201 |
ttt |
203 |
Q |
| |
|
||| |
|
|
| T |
13277622 |
ttt |
13277624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 36808619 - 36808579
Alignment:
| Q |
163 |
atttcattgttgagaaataaagccataaatgattggttttt |
203 |
Q |
| |
|
||||||||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
36808619 |
atttcattgttaagaaataaagtcataaaggattggttttt |
36808579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University