View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14957_low_9 (Length: 401)
Name: NF14957_low_9
Description: NF14957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14957_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 16 - 389
Target Start/End: Complemental strand, 34380275 - 34379902
Alignment:
| Q |
16 |
aaaccatggtggattcgactacccaattcacttttctacgccaaccggtttacactgctttaaagaacgaattcgcaatccaaaccaaaaatatactaac |
115 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34380275 |
aaaccatggtggattcggctacccaattcacatttctacgccaaccggtttacactgctttaaagaacgaattcgcaatccaaaccaaaaatatactaac |
34380176 |
T |
 |
| Q |
116 |
atctttaggtgacccgaagtttgttttccaaagtgttatggatttgtgttttagggttccaatcgggtcgactcttccaattttaccggttgtgacattg |
215 |
Q |
| |
|
| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34380175 |
acctttaggtgacccgaagtttgttttccaaggtgttatggatttgtgttttagggttccaatcgggtcgactcttccagttttaccggttgtgacattg |
34380076 |
T |
 |
| Q |
216 |
atgtttgatggggcggagttgagggtgaccggagagagattgttatataaagtgagtaatgtggcaaagagtaatagttggatttattgtttcacttttg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34380075 |
atgtttgatggggcggagttgagggtgaccggagagagattgttatataaagtgagtaatgtagcaaagagtaatagttggatttattgtttcacttttg |
34379976 |
T |
 |
| Q |
316 |
ggaactctgatttgttggggattgaggcatttattattggacatcatcatcaacagaatgtttggatggagtat |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34379975 |
ggaactctgatttgttggggattgaggcatttattattggacatcatcatcaacggaatgtttggatggagtat |
34379902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 300 - 387
Target Start/End: Complemental strand, 30634152 - 30634065
Alignment:
| Q |
300 |
tattgtttcacttttgggaactctgatttgttggggattgaggcatttattattggacatcatcatcaacagaatgtttggatggagt |
387 |
Q |
| |
|
||||||||||| ||||| || || ||||||||||| |||||||||| ||||||||||||| |||||||| |||||| |||||||||| |
|
|
| T |
30634152 |
tattgtttcacgtttggaaattcagatttgttgggaattgaggcatatattattggacattatcatcaaatgaatgtgtggatggagt |
30634065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University