View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14958_high_2 (Length: 329)
Name: NF14958_high_2
Description: NF14958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14958_high_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 5 - 224
Target Start/End: Complemental strand, 22766546 - 22766326
Alignment:
| Q |
5 |
atatatgttcattatttaatgatgttgattcattcacagaagtgatttatatgtgttttctgttatctattcagattgcaggcagtgatggaaactgagg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22766546 |
atatatgttcattatttaatgatgttgattcattcacagaagtgatttatatgtgttttctgttatctattcagattgcaggcagtgatggaaactgagg |
22766447 |
T |
|
| Q |
105 |
atgcggtgtttctcgtttatgagcattttcacactagtcttcg-aaacacctcgccaatccggagtttttaaacattccaaactggaaaaaagtaagtca |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22766446 |
atgcggtgtttctcgtttatgagcattttcacactagtcttcgaaaacacctcgccaatccggagtttttaaacattccaaactggaaaaaagtaagtca |
22766347 |
T |
|
| Q |
204 |
acttttgttaacaattctgtg |
224 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
22766346 |
tcttttgttaacaattatgtg |
22766326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University