View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14958_low_4 (Length: 282)
Name: NF14958_low_4
Description: NF14958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14958_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 128 - 264
Target Start/End: Original strand, 2474795 - 2474928
Alignment:
| Q |
128 |
ttaccttgaaataaggaggaaaaagttattggttgatcttatcgttggttcttactataaaatcatcatgagtttaaaagaaaaaatgaattgcttcgaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2474795 |
ttaccttgaaataaggaggaaaaagttattggttgatcttatcgttggttcttactataaaatca---tgagtttaaaagaaaaaatgaattgcttcgaa |
2474891 |
T |
|
| Q |
228 |
aaagagcaacataaaaggatggaccgtcctccaagtt |
264 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2474892 |
aaagagcaacataaaacgatggaccgtcctccaagtt |
2474928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 2474681 - 2474778
Alignment:
| Q |
1 |
taacttccctacaaactctgctctgaatggcaaggaaggagaattttgctatgaaggtag-tttgatgtagattataaacgacttttctgcatatggt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2474681 |
taacttccctacaaactctgctctgaatggcaaggaaggagaattttgctatgaaggtagttttgatgtagattataaacgacttttctgcatatggt |
2474778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University