View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14959_high_9 (Length: 286)
Name: NF14959_high_9
Description: NF14959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14959_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 10 - 270
Target Start/End: Original strand, 44155372 - 44155632
Alignment:
| Q |
10 |
gacatcatcacgtgataatgatatatacacaaagttggtaacgttattctaataattcacactacatgtgaatgtaaaatgctaacgttgctttcattta |
109 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44155372 |
gacatcagcacgtgataatgatatatacacaaagttggtaacgttattctaataattcacgctacatgtgaatgtaaaatgctaacgttgctttcattta |
44155471 |
T |
|
| Q |
110 |
ctactaggttaactacattcttggggataacccgttgggaatgtcctacatggttggttatggtgcacgctacccacggaggatacaccatagaggaagc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44155472 |
ctactaggttaactacattcttggggataacccgttgggaatgtcctacatggttggttatggtgcacgctacccacggaggatacaccatagaggaagc |
44155571 |
T |
|
| Q |
210 |
tcaattccctcagtttcagcccatccagcccacattggatgcaaagctggttctcagtatt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44155572 |
tcaattccctcagtttcagcccatccagcccacattggatgcaaagctggttctcagtatt |
44155632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University